Protein expression and purification
Gene encoding the TPR domain of T. cruzi PEX5 (347668) was optimized for E. coli codon usage, synthesized by Integrated DNA Technologies (Coralville, USA) and cloned between NcoI and NotI restriction enzyme sites into petHSU vector. The resulting construct contained an N-terminal Hexa-histidine (His6) tag and a SUMO tag. For AlphaScreen the same gene was amplified using forward 5-TACGACCATATGGAAACCAATTATCCTTTTG and reverse 5-TACGACCTC GAGAACCGCCATGTCCTCCAAG primers and cloned into pET-24a(+) vector between NdeI and XhoI restriction sites resulting in a construct containing C-terminal His6-tag.
The relevant plasmid was transformed into E. coli BL21 (DE3). A single colony was inoculated in 50mL LB medium containing 10g/mL kanamycin and incubated overnight at 37C. 5mL of the preliminary culture were used to inoculate 500mL of LB medium supplemented with 50g/mL kanamycin and incubated at 37C. When the OD600 reached 0.8, the culture was cooled to 20C, induced with 1mM isopropyl -d-1-thiogalactopyranoside(IPTG) and the culture was continued overnight. The cells were then harvested by centrifugation and resuspended in lysis buffer containing 50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol, 40M AEBSF-HCL (protease inhibitor), 1g/mL DNAaseI and lysed on ice by sonication. The lysate was clarified by ultracentrifugation. The supernatant was applied to a HiTrap IMAC column pre-equilibrated with the lysis buffer and washed with abundant washing buffer (50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol). The His-SUMO tag was cleaved off overnight, directly on column, using dtUD1 protease. The flow-through was then collected, concentrated to 5mL using a 30kDa cutoff Amicon Ultra filter and applied to a size exclusion chromatography on High load S75 pre-equilibrated with 20mM Hepes pH 7.5, 100mM NaCl and 5mM -mercaptoethanol. 6-His-tagged TcPEX5 variant was concentrated to 5mL and further purified by size exclusion chromatography on High load S75 pre-equilibrated with PBS supplemented with -mercaptoethanol straight after being eluted from HiTrap IMAC column. The protocol yielded on average 30mg of TcPEX5 from 1L of bacterial culture.
Perdeuterated 15N-labelled TcPEX5 was expressed in M9 minimal medium prepared in D2O and containing 15N-ammoniun chloride as the sole nitrogen source. 5mL of preliminary culture were used to inoculate 500mL of the same medium. Cells were grown at 37C until the OD600 reached 0.8, the culture was cooled to 18C, induced with 1mM IPTG and maintained overnight. The pellets were collected and the protein was purified as described above. In the last step of purification, the protein was applied to a size exclusion chromatography on S75 pre-equilibrated with NMR buffer (50mM phosphate buffer pH 7.4, 150mM NaCl and 5mM -mercaptoethanol).
All FP measurements were performed on a multifunctional microplate reader (Tecan InfinitePro F200 plate) in Corning NBSblack 96-well or 384-well NBS microplates. 485-nm excitation and 535-nm emission filters were used. The FP values were calculated as follows:
$$FP=frac{{I}_{parallel }-{I}_{perp }}{{I}_{parallel }+ {I}_{perp }}$$
where ({I}_{parallel }) and ({I}_{perp }) are the emission light intensity parallel and perpendicular to the excitation light plane, respectively. Fluorescence polarization values were expressed in millipolarization units (mP).
In the FP saturation binding experiment, 10nM 6-FAM-labelled PTS1 (6-FAM-YQSKL) was mixed with increasing concentrations of TcPEX5 (0.1250nM) in FP buffer containing 10mM Hepes pH 7.5, 100mM NaCl and 5% DMSO. Each data point was determined in triplicate. The FP values were plotted against the log10 of the protein concentration, and the dissociation constant (Kd) was obtained by fitting the experimental data using an equation representing a one site non-cooperative ligand binding:
$$FP={FP}_{min}times frac{left({FP}_{max}- {FP}_{min}right)times c}{{K}_{d}+c}$$
where FP is the determined value of the fluorescence polarization, FPmin is the value of the fluorescence polarization of the peptide alone, FPmax is the maximum value of the fluorescence polarization (saturation), Kd is the dissociation constant and c is the protein concentration.
Competitive binding experiment was performed at 10nM 6-FAM-labeled PTS1 and TcPEX5 concentration yielding f0=0.8 according to Huang18. An in-house 30,000 molecules diversity set (ChemBridge, ChemDiv, Enamine, PPI) and FDA-approved drug library were used in high throughput screening. The selection criteria for the diversity libraries are: (i) diversity within each library and between the 3 diversity sets; (ii) MW<600g/mol; (iii) compounds with acceptable logS/logP for solubility; (iv) Lipinskis rule of 5; (v) Purity>90%. Reactive, unstable and toxic chemical groups, chemotypes of known acute or chronic toxicity and trivial compounds present in commercial random libraries have been filtered out. Each tested compound (50mM in DMSO) was transferred into each well of 384-well assay plate with a robotic delivery system. Mixtures containing 30nM TcPEX5 and 10nM 6-FAM-PTS1 were dispensed into the compound containing wells with a reagent dispenser. In each assay plate, DMSO and unlabeled PTS peptide were used as negative and positive controls, respectively. Wells containing 10nM 6-FAM-PTS1 only were used as additional controls. The inhibitory activities were calculated using the following equation: %Inhibition=100(mPnmPs)/(mPnmPp); where mPn, mPp, and mPs represent FP values of the negative controls, positive controls, and compound samples, respectively.
Prior to HTS the assay performance was evaluated using Z test according to19:
$${Z}^{{prime}}=frac{1-(3{SD}_{n}+3 {SD}_{p})}{{mu }_{n}-{mu }_{p}}$$
where SDn and SDp are the standard deviations, and n and p represent the means of the FP values obtained from the negative and positive controls, respectively. For this test each 384-well plate contained 190 negative control wells (labelled peptide and protein), 190 positive control wells (labeled peptide, protein, and unlabeled PTS1), and four 6-FAM-PTS1 only wells. All experiments were repeated three times.
1H, 15N heteronuclear single quantum coherence (HSQC) spectra were measured for uniformly perdeuterated 15N-labeled TcPEX5 (120M) in the absence or presence of ligands at 1:1 protein:ligand molar ratio. 10% (v/v) of D2O was added to the samples to provide the lock signal. Water suppression was carried out using the WATERGATE sequence20. All spectra were recorded at 298K using a Bruker Avance 600MHz spectrometer with a cryogenic TCI probehead. 1H15N heteronuclear correlations were obtained using the SOFAST-HSQC experiment21. Spectra were processed and visualized using TopSpin 4.0.2.
AlphaScreen assay was used as an orthogonal assay to test the ability of compounds of interest to dissociate PEX5PTS1 interaction. 100nM N-His-PEX5 was mixed with 50nM biotinylated PTS1 (YQSKL) in a PBS buffer supplemented with 5mg/mL of BSA and 0.01% (v/v) Tween-20. 5g/mL of streptavidin donor beads and 5g/mL of nickel chelate acceptor beads (PerkinElmer) were added to the mixture. For EC50 determination, serial dilutions of the inhibitors prepared in DMSO were added while keeping constant concentration of DMSO at 5% (this concentration was shown to have no effect on the assay readout). Signal was determined according to the bead manufacturer instructions. Data were analyzed using Origin Pro 9.0. Experimental points were interpreted using Hill sigmoidal fitting fixing the asymptotes at the maximal assay signal (no inhibitor added) and 0, respectively.
The trypanocidal activity of tested compounds was evaluated against T. brucei brucei bloodstream form (BSF) using resazurin-based 96-well plate assay. T. b. brucei BSF (Lister 427, MITat 1.2) parasites were grown in HMI-11 medium containing 10% fetal bovine serum (FBS) at 37C at 5% CO2. 1:1 serial dilutions (10 points) were prepared in quadruplicates for each compound in HMI-11 medium (100L/well). Additionally, each row contained a well without a compound and one with medium solely as controls. 100L of parasite cultures (4103/mL) were inoculated in all wells (except the control with medium alone) so that the final concentration of parasites was 2103/mL. The plates were incubated for 66h. 25L of 0.1mg/mL resazurin (in Hanks Balanced Salt Solution) was added to each well and further incubated till 72h timepoint. The reduction of resazurin was detected by following the fluorescence emission at 585nm (excitation 530nm) using a Synergy H1 microplate reader. The fluorescence emission of the well containing medium only was considered as background and subtracted from the fluorescence emission of other wells; then the percent survival values were calculated setting the fluorescence emission of the well without the compound at 100% survival. Experimental data points were fitted with a non-linear regression using GraphPad (6.04) and the half-maximal inhibitory concentration (IC50) values were derived from the corresponding sigmoidal doseresponse curves.
Recommendation and review posted by G. Smith
